Main Contents
October 22, 2008
My wireless got messed up for some reason over the weekend. I’d left my laptop over at a friend’s for a couple of days while I hung out with my brother, and when I got back and powered it up, wireless was mysteriously not working (maybe NOT mysteriously since I vaguely remember doing a dist-upgrade before shutting down the last time, but anyway). I’d been using ndiswrapper with WinXP drivers I downloaded from the Compaq driver site (my laptop is a Compaq Presario V3000 - Broadcom 4312 Wireless).
Here’s what it says from lspci:
01:00.0 Network controller: Broadcom Corporation BCM4312 802.11a/b/g (rev 01)
If you’ve got the same controller or laptop, then this might be useful.
So anyway, I tried uninstalling ndiswrapper, reinstalling it, no go. Tried purging all my old ndiswrapper configs and such, grabbed new drivers from Compaq, reinstalled ndiswrapper, and for a while it worked. Then after a few more power cycles, it went missing again. Tried b43-fwcutter, which detected my controllers nicely, but wouldn’t let me connect to any wireless networks.
That’s when I tried looking for other drivers, other than from the Compaq site (I heard Dell drivers would work as well), in the hopes of using those with my ndiswrapper, when lo and behold! I stumbled upon this bit of news! Oh joy! Excited, I hurried over to their download page here and downloaded the 32-bit version and read the readme while waiting.
Here’s the gist of what the instructions were:
Untar the file hybrid-portsrc-x86_32_5_10_27_6.tar.gz (hybrid-portsrc-x86_64_5_10_27_6.tar.gz if you’re running on a 64-bit kernel) in its own folder:
tar -xvzf hybrid-portsrc-x86_32_5_10_27_6.tar.gz
You should now see this in your directory listing:
hybrid-portsrc-x86_32_5_10_27_6.tar.gz
lib
Makefile
src
Now build the Loadable Kernel Module (LKM) like so:
make -C /lib/modules/`uname -r`/build M=`pwd`
Of course, you need to make sure you have all the required kernel headers before building it. Once that’s done, your directory listing should look like this:
built-in.o
hybrid-portsrc-x86_32_5_10_27_6.tar.gz
lib
Makefile
modules.order
Module.symvers
src
wl.ko
wl.mod.c
wl.mod.o
wl.o
The magic file we need is wl.ko. Make sure you don’t have b43, b43legacy or b43xx loaded by running this:
rmmod bcm43xx; rmmod b43; rmmod b43legacy
And for good measure remove ndiswrapper modules:
rmmod ndiswrapper
Now load the module ieee80211_crypt_tkip:
modprobe ieee80211_crypt_tkip
And finally load the wl.ko module:
insmod wl.ko
Now if you do an ifconfig, you should see wlan0 right after your eth0 and lo devices. Yippee-kay-yay! Test it out by scanning and connecting to a network. If it works, then you might want your module to load upon boot, which is something the Broadcom readme doesn’t touch on. Let me school you how.
Copy the wl.ko file to /lib/modules/2.6.26-1-686/kernel/net/wireless/
cp wl.ko /lib/modules/2.6.26-1-686/kernel/net/wireless/
Create the module dependencies:
depmod -a
Try loading your new module!:
modprobe wl
If you get no error on modprobe, then it worked perfectly! Next you have to tell your system to load the module at startup. On my debian system, I do this by editing the file /etc/modules to include the following:
ieee80211_crypt_tkip
wl
Now, reboot and you’ve got official Broadcom wifi goodness! Hooray! Ubuntu 8.10 (due out the end of this month) will have this driver bundled with it, here’s hoping that Debian will have it in its repositories soon! Of course, all the above was done on my GNU/Debian Lenny/Sid system, so let me know if you tried it out on yours and tell me how it worked for you. Cheers!
Filed under: Jomcode, Linux |
Comments (13)
July 28, 2008
On the second day, Sunday (that was yesterday), there was a Wifi cracking session that was pretty interesting, although it was pretty much standard Kismet/Airsnort/Airfart fare. The description of the various chipsets and hardware extensions were quite informative though.
After that was Ditesh’s ‘The Malaysian Free Software Community’ session which highlighted a whole facet of the Open Source community and activities in Malaysia that a lot of us weren’t aware of. It would seem that there are quite a number of Malaysians, including Ditesh himself, who are not only devout advocators of FOSS, but also active contributors in various Open Source projects from MySQL to Linux drivers to FreeBSD hacks. Props to Ditesh and all the other Malaysian FOSS proponents, make Malaysia proud!
Oh, and Meng Wong had held a discussion pertaining to how he thought Web 2.0 was about to jump the shark. I can’t remember if this one was on the 1st or 2nd day though. I might have been slightly stoned. But anyway, the discussion was interesting and the attendees gave their own ideas about where they thought the future of web lay.
The generosity of ZoeCity provided the participants with Subway subs for lunch! Yippee-kay-yay! And cookies!
After lunch, there was a ‘lightning session’ where anyone with any interesting or kewl ideas/thoughts would be given 5 minutes to present them. I didn’t know this at the time, but apparently Aizatto was supposed to be handling the lightning sessions. I had launched into the first lightning presentation which might have been titled ‘How to stash your pr0n’. Regarding TrueCrypt for encrypting your pr0n on Windows, Ditesh said on his post that it is apparently broken :(. Guess you guys will have resort to having 150MB dlls named ’sasha_grey.dll’ in your system folder.
Anyways, right after my talk, since I didn’t know there was supposed to be some sort of chairperson running the show, I just decided to invite the next person who wanted to present their thing. I particularly enjoyed this whole lightning session because it was honest and raw. The impromptu ’speakers’ didn’t worry much about a ‘proper’ presentation and instead focused on getting their ideas out passionately. Quite a number of interesting ideas and concepts were thrown around that might not have been quite in place if they were sessions on their own. Arzumy talked about ‘how to hack geeks’ which was about social engineering geeks to get them to do stuff for you for free! Meng Wong talked about his version of the next step in online social networks: Gossip 2.0 or ‘Who’s fucking who now?’. I’m not entirely sure if he did it purely in jest, but I think it just might work. Heh. Hopefully someone might work on this one.
This 16 year old dude, can’t remember his name, talked about his application which not only aggregated blog content, but also analysed their content. Presumably to be able to group together relevant content. I’ll see if anyone has further information on this.
I also invited Devan, who had been telling us about his Thai adventures in underground programming at lunch to talk about it during the lightning sessions. I thought his story was amazing! I myself would love to be doing just that, travelling around the globe, meeting and learning from people around the world. Ditesh presented something along this vein with ‘Couch Surfing‘, a network connecting travelers with locals offering accommodations and advice. There was another site mentioned by someone else in this regard, but I can’t for the life of me remember what it is right now. I have it written down on a piece of paper which is at home. I’ll update later.If I remember and am not entirely too stoned out of my mind.
Kagesenshi talked about Fedora and it’s RPM system. And also some other stuff about Fedora, interspersed here and there during the lightning sessions. It’s very admirable this dude’s enthusiasm for his distro of choice. He’s also got a Fedora con kind of thing in the works. Good luck and good job mate!
Kamal did a short one about unlocking the iPhone 1st gen. He apparently had helped someone to hack their iPhone on Saturday, and decided to present how to do it during the lightning session on Sunday. Big ups!
All in all, a very satisfying first run for an ‘unconference’ I should think. And funnily enough, I thought the lack of rigidity and a sort of slight ‘disorganisation’ made Barcamp a very flexible event, which made it less cluttered and unorganised than supposedly ‘properly planned’ actual conventions. In fact, I’d say Barcamp mostly went without a hitch, and went according to plan, because there weren’t much plans to be worried about in the first place! I can’t wait for the next Barcamp Malaysia! Woohoo!
Filed under: Jomcode, Observations |
Comments (2)
July 28, 2008
Yesterday evening marked the conclusion of the two day Barcamp Malaysia ‘unconference‘ which I personally thought was a roaring success! The presenters were awesome, and the participants were amazing and fun to be around. The energy in the place was off the hook!
I arrived late on opening day, Saturday, on account of working on some stuff with Roni of Ureka Labs the night prior. Actually it was more on account of flipping thru Facebook after that.
“I gotta go catch some z’s. Tomorrow gotta wake up early”, said Mr. Time Management and proceeded to pointlessly page through his friends’ profiles on Facebook until 4 a.m.
Plus, I was supposed to have manned the registration counter in the morning. So much for that. Sorry dudes! But being an unconference and very flexible, somebody else volunteered (I would assume) to cover for me. Aah, the spirit of community!
I missed the ‘GSoC’ and Drupal sessions in the morning, but got there just in time for Roni’s presentation on ‘Monetizing Youtube’. I, for one, think he’s definitely got something going with his idea. Cheryl Goh (lucky her, she won the Nokia Communicator on day 2) wrote a bit about his session here. Right after that I managed to hear the last 10 minutes of Kris Khaira’s ‘Design for Developers’. Talented guy that Kris.
After lunch and some mingling, I decided to see the session on ‘Aggressive Web Development’. I can’t say I agree with everything MikkoK from GettingPersonal had to say, but I definitely think his thoughts on self confidence and positive vibes rang true.
The end of day 1 saw a sizeable group attend Arzumy, Kris khaira and Khailee Ng’s passionately energetic presentation, ‘Entrepreneur+Developer Gangbang‘. Kris’s portion of the presentation about co-working spaces especially interested me.
Some of the participants slept over at the venue, most blacking out part-way through a movie we played on projector, while I braved the night alone watching ‘The Big Bang Theory’, a sitcom about a couple of geeks whose new neighbour happens to be a hot albeit slightly airheaded babe. The nerds go over to introduce themselves, geeky hilarity ensues! Thanks to Ching (I think that’s how you spell her name, Daniel’s counterpart in any case) for introducing that series.
Filed under: Jomcode, Observations |
Comments (5)
July 18, 2008
I don’t normally give a shit about the drama Melayu that is Malaysian politics, but the recent hoohaa about Anwar’s DNA got me a bit curious. More confused than curious really. The question that’s got me perplexed is this: What are they going to check Anwar’s DNA against?
I’m no Sherlock Holmes, but aren’t they supposed to have DNA samples scraped from the alleged victim’s craphole first? I’m pretty sure that’s how they do it in CSI New York. CSI Miami doesn’t need DNA tests; they’ve got the Hummer driving dipshit Horatio.
He is a liar. I just don’t know what the lie is yet.
-Actual quote by Horatio “I don’t need no fucking evidence” Cane
Maybe that’s who the Malaysian Forensics and Cops are using as a benchmark. If Horatio can do it, we also can!Malaysia Boleh!Screw forensics and empirical evidence.
Reading the papers today, it’s quite evident that the authorities involved simply don’t know what the fuck they’re talking about. The way they’re talking, it might sound to the uninitiated that Anwar’s DNA will be able to tell them exactly where Anwar’s dick has been.
You see this sequence of letters right here?
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGG
ITCCTCGCITFUCKEDTTTGATHATACCBOYCAGINCAGTGCTHECCCPOOPERGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGA
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGC
TTTAATTACAGACCTGAA
Yeah, that’s Anwar’s DNA. Let me highlight a particular segment of this sequence:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGG
ITCCTCGCITFUCKEDTTTGATHATACCBOYCAGINCAGTGCTHECCCPOOPERGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGA
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGC
TTTAATTACAGACCTGAA
We rest our case, your Honour.
To further exemplify their idiocy, some fella called Ismail Omar upon being asked why the police refused to use the previous DNA sample from Anwar in 1998 replied “we’re not interested in talking about the past”.
Right.
Because although this Anwar looks almost exactly like the Anwar of 1998, with the same mannerisms and behaviour, on a molecular and genetic level they are two completely different people since Anwar apparently went to Europe to get a new set of DNA and genes, instead of a spine fixup like many of us think.
2008 1998
Fig 1 & 2: Same fucking person, different goddamned DNA
Makes you wonder what they mean when they use the words “credible” and “reasonable” in any sentence. Somebody needs to school these people. School ‘em hard.
Filed under: Liberty or Death, Observations, random thoughts |
Comments (5)
May 15, 2008
Reading the comments over at Obefiend’s and I couldn’t help but notice that everyone else gets mad when Manchester United come out tops and their team loses. What a bunch of sore losers. Obefiend, bless his level headedness, realizes that the grim reality of the situation is that: a) Football is a game of skill and strategy, not luck and chance b) Chelshit haven’t got a chance of winning the league anymore this season (possibly due to the fact that the number of games left to be played where points can be won is exactly zero, or so I’ve been told),and that c) Manchester United are obviously the best team in the whole wide Universe and beyond.
Oh, to be sure, his loyalty still lies with that crappy, blue jerseyed, we’re so rich we’ll buy whoever we want but can’t because Manchester United is not a greedy piece of shit team like us, should be relegated, team he calls “Chelsea” (the actual name of the team is Chelshit, in reference to it’s horribly fecal like style of playing footie; it stinks!). It’s just that he, and hopefully fanboys of other such NOT AT THE TOP OF THE TABLE teams, realize that WE FUCKING WON!
But alas, and alack, there are many others who still spout meaningless facts like “at least we’re in the top three” and “if we had another 2 goals we would’ve won”. All are true statements. I admit that much; whatever these people say is fact. Strangely, these ‘facts’ don’t seem to be able to give their teams the extra push to the top of the table.
I mean, Arsenhole is nowhere near the top ten (is it? I don’t really know because I only look at the team at the top. Just the one right at the top because that’s the only place in the whole table that ACTUALLY MATTERS). Again I might be lying because I don’t known football, but based on the Billboard Top 100, the top listed song is, *generally* the most winningest and most skillful team on the planet. I mean song. Which,to me, means that Chelshit and Arsenhole might as well have been relegated to First Division because they STILL WOULDN’T BE AT THE TOP OF THE PREMIER TABLE! (I edited that so say “Premier Table”, because someone told me the First Division teams are utter crap, and Arsenhole and Chelshit just might be able to top THAT table. Liverfool on the other hand is a different matter).
I’ve run out of juice to talk about Football. In parting, let me tell you that I watched this short video of Ronaldo (he’s the greatest player in the whole of Brazil they tell me) running rings around hapless defenders of less skillful teams (which is generally known to be ANY TEAM BESIDES MANCHESTER UNITED). Guess what said (obviously less agile) defenders did in order to thwart Ronaldo and his magical samba dribbling skills? Go on, guess. You say “employ some fast footed thievery skills to rob him of the ball”? Nope (besides, I already told you they’re less agile. Who is less agile? Anyone who isn’t Ronaldo, that’s who). I hear someone shout “they used a sneaky, but thoroughly smart offside trap that made Ronaldo go ‘Awww…you got me…that was a perfectly setup offside trap fellas.’ ” but you’d be wrong. I’ll tell you what they did. The evil defenders decided to go the mafia way and tried repeatedly (albeit without much success) to break his legs. They kicked him and tackeld him hard, back, front, side, in the head, anywhere. Essentially, they were as unsportsmanlike as could possibly be. Yet Ronaldo always would get up and smile at the camera and point at his legs and say “You can’t break me! I’m Ronaldo! Godsent football superstar!”. That video alone should be testament enough to the humongous talent that is MU.
Glory glory and all that rubbish.
Filed under: Footie Fanboyism |
Comments (5)
May 13, 2008
Tiga ahli puitis, Si Pekak, Si Tempang dan Si Buta berbalas puisi dan pantun untuk menentukan siapakah karyawan yang paling berwibawa pada dekad ini! Saksikannya sendiri di:
http://jomcode.com/jeruy
Filed under: Links |
Comments (3)
May 13, 2008
I’ve decided for no reason in particular, to start writing about football. Or to be more precise, my personal insights into football. Which is to say, absolute bullshit. Actually there is a reason. A reason that I think is the answer to why boys like to watch football; fanboyism.
We’ve all been fanboys of something at some point in our life. I was a Nintendo Fanboy once. I used to loathe Sega stuff with a vengeance. Mario is, indubitably, one of the most throughly fun games anyone had played, but on the 8-bit Nintendo it was nowhere near as fast as Sonic. That blue fucker is made of pure speed.
I knew the Genesis was more technically advanced than the Nintendo, but I’d always find find conclusive evidence through extensive research (a.k.a completely made up bullshit) that pointed to Nintendo as clearly being the superior platform. Being the nice kind of guy that I am, I would always share this obviously invaluable piece of information with my Sega friends. We’d argue about it, then somebody would mention Hasanal’s NeoGeo and we’d all shut up.
And therein, my friends, lies the secret to why we choose to be fanboys of a particular something; being able to ruin other peoples’ picnic when our chosen obsession is proven superior. With lots of profanity and senseless loyalty driven bullshit sermons preferably. 
In other words, your team chokes on my dick while mine is the ultrakewl.
I’ve recently found the joys of being a footie fanboy. I’ve never really engaged myself in any footie conversation. Mostly because I don’t watch much football anyway. I did always like Man U though, when they had Schmeichel and Cantona and the younger version of Giggs, and the younger version of those twins. Orville I think. Neville. Gary and the other Neville. Whatever, they were awesome to watch. But I still was never into it into it.
Until I noticed how pissed off the fanboys of other teams get when people start gloating when their team loses. I started doing it to Ayiep;Primero Uno Liverfool fanboy. I’d send him smses whenever I found out MU beat them. We’d have hilarious sms battles. Hilarious for me. Haha. A few weeks back, I started pissing in Jeruy’s cereal when MU beat Arsenhole.
Whoowee! Motherfucker got pissed off! He ended his SMS with “and you’re not even a FOOTBALL FAN!” A week later (I don’t even know how this was possible, MU playing Arsenhole again within a week. I think it was some Champions league thing) and Arsenhole won, redeeming whatever dignity they had left from being constantly thrashed by us (that’s another fanboy thing; personal association with obsession of choice), when Jeruy sent me this SMS:
How do you like that now, football fan??!?
I grinned so wide even the Joker wouldn’t be able to pull it off. The War has just started. More recently, I’ve been reading some football entries over at Obefiend’s blog, quite understandably heaping praise upon and glorifying his beloved Chelshit since he likes that sorry excuse for a football team for some sick reason. (Again I display some classic fanboyism here: pounding Chelshit as being a lousy team when I’ve probably watched them play a full game in total of maybe 6 times throughout my entire life. And fanboys don’t have to justify How convenient). Sensing an opportunity to irk yet another fanboy of some randomly chosen team (really, how DOES one choose their favourite EPL teams?) I started sending him some nice juicy sarcasm wrapped in some ’suck this’ sauce in his comments. The latest one I posted I really liked, and decided to use that to start off my foray into the world of sports blogging. Or “Shitting on other teams just because I like Man United”. Let the tomfoolery begin!
Filed under: Footie Fanboyism |
Comments (6)
April 30, 2008
Going through this post in a friend’s blog, I was reminded of a story I once heard someone tell me concerning faith in a way. I can’t retell it verbatim, so if anyone has a more exact version, or if I got the story wrong, do let me know. Here is the story as I can recall:
An opponent of Islam approached an Imam who was a teacher of Islam and said to him “Who is this God that you worship? You cannot see him, nor hear him, or feel him nor smell him”.
“Tell me how is it that you can believe in a thing that you cannot prove to exist? Answer me that!” he asked the Imam cockily, thinking he had asked a question that would be unanswered by the religious man.
The Imam looked calmly at the non-believer, lifted his hand and promptly smacked the other man across the face.
The non-believer’s eyes widened in surprise. While he was still reeling from shock, the Imam asked him “Does it hurt?” to which the heathen replied indignantly “Of course it hurts!”. Without skipping a beat, the Imam continued “But how can I believe that you have pain? I cannot see your pain, nor hear your pain, not taste it, nor feel it.”
And with this, the non-believer was enlightened.
Update: I just happened to see this post over at Obefiend’s. It’s sad knowing that people who think like this still exist. And it’s even sadder that these very same idiots seem to forward me their shit in the mail, condemning me to an eternity of hell if I even think of deleting it. If only it were as easy as hitting the forward button to get in God’s good grace. Bloody idiots.
Filed under: Observations, religious fervour |
Comments (0)
April 29, 2008
Throngs of drones, identical in their pressed shirts and ties, decide to have lunch at 1.00 pm, because naturally that’s the time when humans feels hungry. “I’m an individual” you hear one of them voice. You turn your head to identify this “free soul” who has decided to break away from convention, only to find your gaze lost in a sea of GQ and designer hairstyles. Each exactly the same as the other, gelled spike for gelled spike.
Gelled spikes that hide dreams of big cars and houses, moneys and titles and fame and power. Because that’s what everyone dreams of. That is the definition of success. And who doesn’t want success?
go to work, send your kids to school
follow fashion, act normal
walk on the pavements, watch T.V.
save for your old age, obey the law
Repeat after me: I am free
Filed under: Liberty or Death, Observations |
Comments (2)
April 7, 2008
From jomread.com:
“You know how you sometimes think “I’d like to pick up a good book and sit in and read this Sunday”, but never seem to because you didn’t have time to look for one, or because shelling out RM80 for a book you might end up reading only once seems too wasteful?
Remember one of your friends who not only loves reading books, but loves spreading the knowledge too? The one who will go out of the way just to lend you a great book? All you have to do is just meet up with that particular friend and bring home something to read. Easy, isn’t it?
We are not here to replace you generous friend. But we sure would like to be one of yours. That’s why we would love to lend you one book at a time for you to read, once you’ve finished it, we’ll send you another one.”
Head on over to jomread.com if you love reading!
Filed under: Jomcode |
Comments (5)
