Main Contents
April 4, 2009
I was just thinking about plot twists, and this popped into mind:
It was him. It had been a while, but she was sure it was him. Linda Yusof just flew in from London, got held up at the metal detector, thought she had lost her baggage twice before realizing she was the one who was lost, and got into a shouting match with an immigration officer over her jar of cili jeruk. A peculiar one this Linda, never travelling abroad without her pickled chillies, and that immigration officer learnt that lesson quite promptly. She was having a pretty shitty day when her world was flipped upside down; it was him. He was just outside the arrival hall, waiting for a cab Linda supposed. The last time she saw him was the first time she’d fell in love with him. She was just a boy then.
Filed under: Uncategorized |
Comments (2)
February 28, 2009
Since I’d already posted my prelim report on the Langkawi Ironman, I figured I might as well post my raceday report. Again, if any of you journalisty types read this, do let me know how I’m doing. Here’s the report:
The Langkawi Ironman kicked off this morning at 7.30 and saw 44 professional athletes from 13 countries taking on the waters of Langkawi, followed 15 minutes later by 600 odd amateur ironmen. Some 40 minutes later, the first breakaway group of 5 swimmers were spotted on the return leg of the 3.8km swim course a good 5 minutes ahead of the rest of the pack. It was 2 time Langkawi Ironman champ, Brian Rhodes, who set the pace getting onto his bike first followed by Luke McKenzie of Australia, Japanese Olympian Hiroyuki Nishiuchi, Canada’s Matt Ohalloran and Brazilian Olympian Reinaldo Colucci.
The second batch of athletes out the water saw Japan’s Maki Nishiuchi being the first of the women to head on to the second leg of the competition; the 180km Bike course. She was followed closely by defending champion Belinda Granger. The bike course has been changed a bit this year incorporating one big loop of the island followed by three smaller loops and features a few challenging hills that made the final lap or two a bit of an obstacle for many, but didn’t so much as faze the pros.
The first Amateur, or Age Grouper out the water was Japan’s Hirotsugu Kuwabara, and our very own Frankie Ambrose was the first Malaysian to head to the second leg after completing the swim course in just under an hour.
It proved to be quite an exciting second leg as Luke Mckenzie,Bryan Rhodes and Reinaldo Colucci took turns up front, with Luke taking lead after 30km. They were trailed closely, no more than 5 minutes behind, by Hiroyuki Nishiuchi, Mathieu Ohalloran, and Brian Fuller. Although Maki Nishiuchi paved the way for the women’s category, Belinda Granger who is very comfortable on the bike soon took the lead in the cycling stage, with Maki tailing her closely and Dona Phelan of Canada just 5 minutes behind. This picture stayed pretty much the same until the halfway mark, when for the first time, it wasn’t Luke McKenzie leading the race, but former Olympian Reynaldo Colucci. McKenzie didn’t let him get very far though, as 10 kilometers down the line, he regained pole position.
Of course, everyone was aware that cycling happens to be 2 time Langkawi Ironman Bryan Rhodes’ favourite discipline, and he showed it at the 140km mark, when he broke away, leaving behind Luke McKenzie and reinaldo. In the meantime, The Belinda show seemed to roll on as Granger widened the gap of her lead with each passing kilometer. And at the 170km mark, Donna Phelan overtook Maki to be in second spot.
The placings from the cycling stage didn’t change much in the transition to the final leg of the competition, the 42.2 km marathon. But about 5 km thru the run, Luke McKenzie who’d won the japan Ironman last year, decided he couldn’t have Bryan Rhodes showing him up with a hattrick Ironman win and pulled away to lead the pack. Luke McKenzie and Belinda Granger were scorching the track in their categories respectively, with Bryan Rhodes and Donna Phelan playing catch up. Donna Phelan couldn’t maintain her pace, and was soon overtook by German Nicole Leder, while Maki Nishiuchi regained second place. Leder soon destroyed the tarmac however, with a blazing run and took second place behind overall leader in the women’s, Belinda Granger. About 20 minutes before the first competitor was due at the finish line, rain started pouring. But Luke McKenzie made a quick call to the clouds saying “I’m not done yet!” and the rain promptly stopped, clearing the skies for McKenzie and a victorious Langkawi Ironman championship in the Australian’s hand. He clocked 8 hours 26 minutes and dashed the hopes of a hattrick for Bryan Rhodes, who came in 6 minutes later, followed by Brian Fuller of Australia, who was in the leading pack all the way. A little over an hour later, defending champion Belinda Granger proved that she still is THE Langkawi Ironman as she broke the course record and clocked in an impressive 9 hours and 21 minutes, 8 minutes faster than her previous record. 15 minutes later, Leder arrived, clocking in at 9 hours and 36 minutes. Japanese Maki Nishiuci completed her ironman at third place, in just over 10 hours. And our very own Iron Man, Jasmi Sarael became the first Malaysian Iron man to finish the race, clocking 10 hours and 6 minutes. Each of the top winners take away 8500 usd in prize money, out of a total of 50000 usd in prize money for this, the 10th edition of the iron man langkawi. We’ll look forward to another edition of the toughest show on earth next year.
Filed under: TraxxFM |
Comments (2)
February 27, 2009
I was writing my report for my crossover tonight, and after reading it again, I thought it read like a professional news story that might come out in the newspapers. If you’re a journalisty type person, I’d appreciate comments on how I can Improve my writing. Here’s my report:
Fad da dilly’o reporting from the beautiful island city of Langkawi, where the 10th Langkawi Ironman Triathlon will be commencing tomorrow, the 28th of February. Last night witnessed the official launch of the Langkawi Ironman 2009 at the Carbo Night at the Anjung Jetty. Participants and media were treated to a smorgasboard of food, mostly carbs, for the energy that they’ll need on race day. Present for the ceremony were race director A. Chandrakumanan, and Kedah Youth and Sports Exco, Datuk Othman Aziz who is expected to see the racers off on race day.
The inaugural langkawi Ironman was held in 2000, and thousands have crossed the finish line since then. Tomorrow another 735 participants are expected to run the race, and Malaysia being the host is fielding the largest number of ironmen followed by Japan and Germany. But the Ironman is no walk in the park; with a 3.8km swimming course, 180km bike trail, topped off with a 42.2 km marathon, it’s quite plain to see why the Ironman event is dubbed “the toughest show on earth”. We’ll have to wait and see at the end of tomorrow how many manage to cross the finish line to add to the tally.
Of the total contestants taking part, 44 Professional entries from 13 countries are currently preparing themselves mentally and physically for the gruelling test tomorrow. Competition will be super tough, with Canadian team TVB not taking any chances by fielding 6 of their Ironmen; 3 men and 3 ladies. Also present will be ex-TVB athlete, and last year’s champion, Belinda Granger who’s here for the third time and this time she’s got her title to defend.
Asked how it feels to be competing against her ex teammates from TVB, Granger admitted she is slightly nervous not being in the team because she knows how hard they train. However she said she left the team purely due to sponsorship reasons and is still maintaing good rappor with her former team.
Adding to the pool of athletic talent in this years Ironman are ex-Olympians, Japanese Hiroyuki Nishiuchi and Reynaldo from Brazil. Olympians though they may be, this is not some regular marathon. They’re up against former Ironmen champions, including 2 time Langkawi Ironman champ, Bryan Rhodes. He’ll be taking on Last years Ironman Japan winner Luke McKenzie and perenntial top five Ironman Petr Vabrousek.
The event will also see the participation of PC, or physically challenged competitors. In an exclusive interview with Traxxfm this afternoon after the press conference, Amy Palmiero-Winters, 36 year old native of new york who had her left leg amputated below the knee after a motorcycle accident in 1994, said this would be her 2nd Ironman event and her 1st time in Malaysia. Asked if she’s ready to deal with the Malaysian Heat she said “in any race, the one element you can’t control is mother nature, so you have to make the best of it and take it in stride”. Wearing a custom made prosthetic, she’s got 9 world records under her belt. And to top that, Amy tells me she’s hoping to make it to the Kona Hawaii Ironman, and she plans to get there in her age group category, and not in the PC category as we might have expected. How about that? You can tell that it takes a constitution made of steel, in order to test your mettle, and prove yourself to be the real Ironman. Fad da Dilly’o reporting LIVE from Langkawi, for the 10th, Langkawi Ironman.
Filed under: TraxxFM |
Comments (0)
November 27, 2008
After more than a month of not going through my favourite blogs, I recently found some time to go visit my ol’ pal, Obefiend. Hilarious stuff that.
He was ranting (as he is wont to do) about some comment on a piece of his that denounced the mystical qualities of those magnet bands/necklaces/trinkets that can supposedly (not supposably, dumbfucks. English, learn it!) heal you magically. Of course, I wasn’t able to verify that was exactly what his post was about, since it isn’t bloody there anymore! (Note to Obefiend, you should have a look at that, good sir!).
In said comment the commenter, one not so bright DIQ360, wrote
“ko igt ni magnet yg beli kat kedai hardware or yg dlm speaker tu ke bodoh?? mmg la zaman skang bnyk gelang tiruan! ni magnet neodymium, ND60!”
Ooooo, neodymium magnets. Shame on me, I thought they actually were regular typed magnets you’d find in hardware stores and in speakers. Wonder what this neodymium magnet is. Being the regular sleuth that I am, I decide to find out. But how?
I know! Wikipedia knows all!
5 seconds later, I find myself here (Neodymium - Wikipedia) where I stumble upon this:
“Neodymium magnets are the strongest permanent magnets known - Nd2Fe14B. These magnets are cheaper, lighter, and stronger than samarium-cobalt magnets. Neodymium magnets appear in products such as microphones, professional loudspeakers, in-ear headphones, guitar and bass guitar pick-ups and computer hard disks where low mass, small volume, or strong magnetic fields are required.”
You don’t say? I ROTFLMAO at you DIQ360, for not even bothering to find out what the fuck it is you just bought for 800 bucks; glorified speaker magnets. Dumbshit.
I then proceeded to comment on Obefiends post about said comment. And that comment turned out so nice, I decided to copy that comment and make it this post. Ingenious!
At the end of the comment that became this post, I wrote the following:
I laud you yet again, Obefiend, for a fine rant and altogether delightful rip on yet another idiot who probably says “Thats mean” instead of “That means”. Always a mood uplifter you are. Cheers!
And thus did it end.
It’s a shame though, how religion is being wielded as a weapon to cheat the masses. I think I heard or read somewhere, that one of the signs of the end of times would be when people sell religion, menjaja agama. I wrote a poem once about this very thing, sort of. You may read it here, if it so pleases you. If it doesn’t, it suits me fine. I’m pretty sure there was a lesson in all of this, but I can’t seem to find it. Maybe something about using your brain every once in a while, so as not to be too gullible or appear too stupid. Something like that.
Filed under: Observations, random thoughts |
Comments (3)
October 22, 2008
My wireless got messed up for some reason over the weekend. I’d left my laptop over at a friend’s for a couple of days while I hung out with my brother, and when I got back and powered it up, wireless was mysteriously not working (maybe NOT mysteriously since I vaguely remember doing a dist-upgrade before shutting down the last time, but anyway). I’d been using ndiswrapper with WinXP drivers I downloaded from the Compaq driver site (my laptop is a Compaq Presario V3000 - Broadcom 4312 Wireless).
Here’s what it says from lspci:
01:00.0 Network controller: Broadcom Corporation BCM4312 802.11a/b/g (rev 01)
If you’ve got the same controller or laptop, then this might be useful.
So anyway, I tried uninstalling ndiswrapper, reinstalling it, no go. Tried purging all my old ndiswrapper configs and such, grabbed new drivers from Compaq, reinstalled ndiswrapper, and for a while it worked. Then after a few more power cycles, it went missing again. Tried b43-fwcutter, which detected my controllers nicely, but wouldn’t let me connect to any wireless networks.
That’s when I tried looking for other drivers, other than from the Compaq site (I heard Dell drivers would work as well), in the hopes of using those with my ndiswrapper, when lo and behold! I stumbled upon this bit of news! Oh joy! Excited, I hurried over to their download page here and downloaded the 32-bit version and read the readme while waiting.
Here’s the gist of what the instructions were:
Untar the file hybrid-portsrc-x86_32_5_10_27_6.tar.gz (hybrid-portsrc-x86_64_5_10_27_6.tar.gz if you’re running on a 64-bit kernel) in its own folder:
tar -xvzf hybrid-portsrc-x86_32_5_10_27_6.tar.gz
You should now see this in your directory listing:
hybrid-portsrc-x86_32_5_10_27_6.tar.gz
lib
Makefile
src
Now build the Loadable Kernel Module (LKM) like so:
make -C /lib/modules/`uname -r`/build M=`pwd`
Of course, you need to make sure you have all the required kernel headers before building it. Once that’s done, your directory listing should look like this:
built-in.o
hybrid-portsrc-x86_32_5_10_27_6.tar.gz
lib
Makefile
modules.order
Module.symvers
src
wl.ko
wl.mod.c
wl.mod.o
wl.o
The magic file we need is wl.ko. Make sure you don’t have b43, b43legacy or b43xx loaded by running this:
rmmod bcm43xx; rmmod b43; rmmod b43legacy
And for good measure remove ndiswrapper modules:
rmmod ndiswrapper
Now load the module ieee80211_crypt_tkip:
modprobe ieee80211_crypt_tkip
And finally load the wl.ko module:
insmod wl.ko
Now if you do an ifconfig, you should see wlan0 right after your eth0 and lo devices. Yippee-kay-yay! Test it out by scanning and connecting to a network. If it works, then you might want your module to load upon boot, which is something the Broadcom readme doesn’t touch on. Let me school you how.
Copy the wl.ko file to /lib/modules/2.6.26-1-686/kernel/net/wireless/
cp wl.ko /lib/modules/2.6.26-1-686/kernel/net/wireless/
Create the module dependencies:
depmod -a
Try loading your new module!:
modprobe wl
If you get no error on modprobe, then it worked perfectly! Next you have to tell your system to load the module at startup. On my debian system, I do this by editing the file /etc/modules to include the following:
ieee80211_crypt_tkip
wl
Now, reboot and you’ve got official Broadcom wifi goodness! Hooray! Ubuntu 8.10 (due out the end of this month) will have this driver bundled with it, here’s hoping that Debian will have it in its repositories soon! Of course, all the above was done on my GNU/Debian Lenny/Sid system, so let me know if you tried it out on yours and tell me how it worked for you. Cheers!
Filed under: Jomcode, Linux |
Comments (54)
July 28, 2008
On the second day, Sunday (that was yesterday), there was a Wifi cracking session that was pretty interesting, although it was pretty much standard Kismet/Airsnort/Airfart fare. The description of the various chipsets and hardware extensions were quite informative though.
After that was Ditesh’s ‘The Malaysian Free Software Community’ session which highlighted a whole facet of the Open Source community and activities in Malaysia that a lot of us weren’t aware of. It would seem that there are quite a number of Malaysians, including Ditesh himself, who are not only devout advocators of FOSS, but also active contributors in various Open Source projects from MySQL to Linux drivers to FreeBSD hacks. Props to Ditesh and all the other Malaysian FOSS proponents, make Malaysia proud!
Oh, and Meng Wong had held a discussion pertaining to how he thought Web 2.0 was about to jump the shark. I can’t remember if this one was on the 1st or 2nd day though. I might have been slightly stoned. But anyway, the discussion was interesting and the attendees gave their own ideas about where they thought the future of web lay.
The generosity of ZoeCity provided the participants with Subway subs for lunch! Yippee-kay-yay! And cookies!
After lunch, there was a ‘lightning session’ where anyone with any interesting or kewl ideas/thoughts would be given 5 minutes to present them. I didn’t know this at the time, but apparently Aizatto was supposed to be handling the lightning sessions. I had launched into the first lightning presentation which might have been titled ‘How to stash your pr0n’. Regarding TrueCrypt for encrypting your pr0n on Windows, Ditesh said on his post that it is apparently broken :(. Guess you guys will have resort to having 150MB dlls named ’sasha_grey.dll’ in your system folder.
Anyways, right after my talk, since I didn’t know there was supposed to be some sort of chairperson running the show, I just decided to invite the next person who wanted to present their thing. I particularly enjoyed this whole lightning session because it was honest and raw. The impromptu ’speakers’ didn’t worry much about a ‘proper’ presentation and instead focused on getting their ideas out passionately. Quite a number of interesting ideas and concepts were thrown around that might not have been quite in place if they were sessions on their own. Arzumy talked about ‘how to hack geeks’ which was about social engineering geeks to get them to do stuff for you for free! Meng Wong talked about his version of the next step in online social networks: Gossip 2.0 or ‘Who’s fucking who now?’. I’m not entirely sure if he did it purely in jest, but I think it just might work. Heh. Hopefully someone might work on this one.
This 16 year old dude, can’t remember his name, talked about his application which not only aggregated blog content, but also analysed their content. Presumably to be able to group together relevant content. I’ll see if anyone has further information on this.
I also invited Devan, who had been telling us about his Thai adventures in underground programming at lunch to talk about it during the lightning sessions. I thought his story was amazing! I myself would love to be doing just that, travelling around the globe, meeting and learning from people around the world. Ditesh presented something along this vein with ‘Couch Surfing‘, a network connecting travelers with locals offering accommodations and advice. There was another site mentioned by someone else in this regard, but I can’t for the life of me remember what it is right now. I have it written down on a piece of paper which is at home. I’ll update later.If I remember and am not entirely too stoned out of my mind.
Kagesenshi talked about Fedora and it’s RPM system. And also some other stuff about Fedora, interspersed here and there during the lightning sessions. It’s very admirable this dude’s enthusiasm for his distro of choice. He’s also got a Fedora con kind of thing in the works. Good luck and good job mate!
Kamal did a short one about unlocking the iPhone 1st gen. He apparently had helped someone to hack their iPhone on Saturday, and decided to present how to do it during the lightning session on Sunday. Big ups!
All in all, a very satisfying first run for an ‘unconference’ I should think. And funnily enough, I thought the lack of rigidity and a sort of slight ‘disorganisation’ made Barcamp a very flexible event, which made it less cluttered and unorganised than supposedly ‘properly planned’ actual conventions. In fact, I’d say Barcamp mostly went without a hitch, and went according to plan, because there weren’t much plans to be worried about in the first place! I can’t wait for the next Barcamp Malaysia! Woohoo!
Filed under: Jomcode, Observations |
Comments (2)
July 28, 2008
Yesterday evening marked the conclusion of the two day Barcamp Malaysia ‘unconference‘ which I personally thought was a roaring success! The presenters were awesome, and the participants were amazing and fun to be around. The energy in the place was off the hook!
I arrived late on opening day, Saturday, on account of working on some stuff with Roni of Ureka Labs the night prior. Actually it was more on account of flipping thru Facebook after that.
“I gotta go catch some z’s. Tomorrow gotta wake up early”, said Mr. Time Management and proceeded to pointlessly page through his friends’ profiles on Facebook until 4 a.m.
Plus, I was supposed to have manned the registration counter in the morning. So much for that. Sorry dudes! But being an unconference and very flexible, somebody else volunteered (I would assume) to cover for me. Aah, the spirit of community!
I missed the ‘GSoC’ and Drupal sessions in the morning, but got there just in time for Roni’s presentation on ‘Monetizing Youtube’. I, for one, think he’s definitely got something going with his idea. Cheryl Goh (lucky her, she won the Nokia Communicator on day 2) wrote a bit about his session here. Right after that I managed to hear the last 10 minutes of Kris Khaira’s ‘Design for Developers’. Talented guy that Kris.
After lunch and some mingling, I decided to see the session on ‘Aggressive Web Development’. I can’t say I agree with everything MikkoK from GettingPersonal had to say, but I definitely think his thoughts on self confidence and positive vibes rang true.
The end of day 1 saw a sizeable group attend Arzumy, Kris khaira and Khailee Ng’s passionately energetic presentation, ‘Entrepreneur+Developer Gangbang‘. Kris’s portion of the presentation about co-working spaces especially interested me.
Some of the participants slept over at the venue, most blacking out part-way through a movie we played on projector, while I braved the night alone watching ‘The Big Bang Theory’, a sitcom about a couple of geeks whose new neighbour happens to be a hot albeit slightly airheaded babe. The nerds go over to introduce themselves, geeky hilarity ensues! Thanks to Ching (I think that’s how you spell her name, Daniel’s counterpart in any case) for introducing that series.
Filed under: Jomcode, Observations |
Comments (6)
July 18, 2008
I don’t normally give a shit about the drama Melayu that is Malaysian politics, but the recent hoohaa about Anwar’s DNA got me a bit curious. More confused than curious really. The question that’s got me perplexed is this: What are they going to check Anwar’s DNA against?
I’m no Sherlock Holmes, but aren’t they supposed to have DNA samples scraped from the alleged victim’s craphole first? I’m pretty sure that’s how they do it in CSI New York. CSI Miami doesn’t need DNA tests; they’ve got the Hummer driving dipshit Horatio.
He is a liar. I just don’t know what the lie is yet.
-Actual quote by Horatio “I don’t need no fucking evidence” Cane
Maybe that’s who the Malaysian Forensics and Cops are using as a benchmark. If Horatio can do it, we also can!Malaysia Boleh!Screw forensics and empirical evidence.
Reading the papers today, it’s quite evident that the authorities involved simply don’t know what the fuck they’re talking about. The way they’re talking, it might sound to the uninitiated that Anwar’s DNA will be able to tell them exactly where Anwar’s dick has been.
You see this sequence of letters right here?
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGG
ITCCTCGCITFUCKEDTTTGATHATACCBOYCAGINCAGTGCTHECCCPOOPERGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGA
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGC
TTTAATTACAGACCTGAA
Yeah, that’s Anwar’s DNA. Let me highlight a particular segment of this sequence:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGC
CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGG
ITCCTCGCITFUCKEDTTTGATHATACCBOYCAGINCAGTGCTHECCCPOOPERGGAGAGG
AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGA
CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGC
TTTAATTACAGACCTGAA
We rest our case, your Honour.
To further exemplify their idiocy, some fella called Ismail Omar upon being asked why the police refused to use the previous DNA sample from Anwar in 1998 replied “we’re not interested in talking about the past”.
Right.
Because although this Anwar looks almost exactly like the Anwar of 1998, with the same mannerisms and behaviour, on a molecular and genetic level they are two completely different people since Anwar apparently went to Europe to get a new set of DNA and genes, instead of a spine fixup like many of us think.
2008 1998
Fig 1 & 2: Same fucking person, different goddamned DNA
Makes you wonder what they mean when they use the words “credible” and “reasonable” in any sentence. Somebody needs to school these people. School ‘em hard.
Filed under: Liberty or Death, Observations, random thoughts |
Comments (5)
May 15, 2008
Reading the comments over at Obefiend’s and I couldn’t help but notice that everyone else gets mad when Manchester United come out tops and their team loses. What a bunch of sore losers. Obefiend, bless his level headedness, realizes that the grim reality of the situation is that: a) Football is a game of skill and strategy, not luck and chance b) Chelshit haven’t got a chance of winning the league anymore this season (possibly due to the fact that the number of games left to be played where points can be won is exactly zero, or so I’ve been told),and that c) Manchester United are obviously the best team in the whole wide Universe and beyond.
Oh, to be sure, his loyalty still lies with that crappy, blue jerseyed, we’re so rich we’ll buy whoever we want but can’t because Manchester United is not a greedy piece of shit team like us, should be relegated, team he calls “Chelsea” (the actual name of the team is Chelshit, in reference to it’s horribly fecal like style of playing footie; it stinks!). It’s just that he, and hopefully fanboys of other such NOT AT THE TOP OF THE TABLE teams, realize that WE FUCKING WON!
But alas, and alack, there are many others who still spout meaningless facts like “at least we’re in the top three” and “if we had another 2 goals we would’ve won”. All are true statements. I admit that much; whatever these people say is fact. Strangely, these ‘facts’ don’t seem to be able to give their teams the extra push to the top of the table.
I mean, Arsenhole is nowhere near the top ten (is it? I don’t really know because I only look at the team at the top. Just the one right at the top because that’s the only place in the whole table that ACTUALLY MATTERS). Again I might be lying because I don’t known football, but based on the Billboard Top 100, the top listed song is, *generally* the most winningest and most skillful team on the planet. I mean song. Which,to me, means that Chelshit and Arsenhole might as well have been relegated to First Division because they STILL WOULDN’T BE AT THE TOP OF THE PREMIER TABLE! (I edited that so say “Premier Table”, because someone told me the First Division teams are utter crap, and Arsenhole and Chelshit just might be able to top THAT table. Liverfool on the other hand is a different matter).
I’ve run out of juice to talk about Football. In parting, let me tell you that I watched this short video of Ronaldo (he’s the greatest player in the whole of Brazil they tell me) running rings around hapless defenders of less skillful teams (which is generally known to be ANY TEAM BESIDES MANCHESTER UNITED). Guess what said (obviously less agile) defenders did in order to thwart Ronaldo and his magical samba dribbling skills? Go on, guess. You say “employ some fast footed thievery skills to rob him of the ball”? Nope (besides, I already told you they’re less agile. Who is less agile? Anyone who isn’t Ronaldo, that’s who). I hear someone shout “they used a sneaky, but thoroughly smart offside trap that made Ronaldo go ‘Awww…you got me…that was a perfectly setup offside trap fellas.’ ” but you’d be wrong. I’ll tell you what they did. The evil defenders decided to go the mafia way and tried repeatedly (albeit without much success) to break his legs. They kicked him and tackeld him hard, back, front, side, in the head, anywhere. Essentially, they were as unsportsmanlike as could possibly be. Yet Ronaldo always would get up and smile at the camera and point at his legs and say “You can’t break me! I’m Ronaldo! Godsent football superstar!”. That video alone should be testament enough to the humongous talent that is MU.
Glory glory and all that rubbish.
Filed under: Footie Fanboyism |
Comments (5)
May 13, 2008
Tiga ahli puitis, Si Pekak, Si Tempang dan Si Buta berbalas puisi dan pantun untuk menentukan siapakah karyawan yang paling berwibawa pada dekad ini! Saksikannya sendiri di:
http://jomcode.com/jeruy
Filed under: Links |
Comments (3)