I think we need a bigger body bag.
July 18, 2008
I don’t normally give a shit about the drama Melayu that is Malaysian politics, but the recent hoohaa about Anwar’s DNA got me a bit curious. More confused than curious really. The question that’s got me perplexed is this: What are they going to check Anwar’s DNA against?
I’m no Sherlock Holmes, but aren’t they supposed to have DNA samples scraped from the alleged victim’s craphole first? I’m pretty sure that’s how they do it in CSI New York. CSI Miami doesn’t need DNA tests; they’ve got the Hummer driving dipshit Horatio.
He is a liar. I just don’t know what the lie is yet.
-Actual quote by Horatio “I don’t need no fucking evidence” Cane
Maybe that’s who the Malaysian Forensics and Cops are using as a benchmark. If Horatio can do it, we also can!Malaysia Boleh!Screw forensics and empirical evidence.
Reading the papers today, it’s quite evident that the authorities involved simply don’t know what the fuck they’re talking about. The way they’re talking, it might sound to the uninitiated that Anwar’s DNA will be able to tell them exactly where Anwar’s dick has been.
You see this sequence of letters right here?
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGC CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGG ITCCTCGCITFUCKEDTTTGATHATACCBOYCAGINCAGTGCTHECCCPOOPERGGAGAGG AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGA CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGC TTTAATTACAGACCTGAAYeah, that’s Anwar’s DNA. Let me highlight a particular segment of this sequence:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGC CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGG ITCCTCGCITFUCKEDTTTGATHATACCBOYCAGINCAGTGCTHECCCPOOPERGGAGAGG AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGA CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGC TTTAATTACAGACCTGAAWe rest our case, your Honour.
To further exemplify their idiocy, some fella called Ismail Omar upon being asked why the police refused to use the previous DNA sample from Anwar in 1998 replied “we’re not interested in talking about the past”.
Right.
Because although this Anwar looks almost exactly like the Anwar of 1998, with the same mannerisms and behaviour, on a molecular and genetic level they are two completely different people since Anwar apparently went to Europe to get a new set of DNA and genes, instead of a spine fixup like many of us think.
2008 1998
Makes you wonder what they mean when they use the words “credible” and “reasonable” in any sentence. Somebody needs to school these people. School ‘em hard.
Filed under: Liberty or Death, Observations, random thoughts | Comments (7)
welcome back sir! we miss you
that new gattaca sequence intrigued me. that should confirm the story that anwar is a REPTILIAN. they are taking over this world one country at a time son!
but seriously
since when do pulis need proof to proecute here? all they need is some elbow grease and broomstick. elbow grease are use to loosen up the tongue and maybe if time premits ribcage,pelvis,scapula, femur bla bla. if the accuse still refuse to fess up they shove a brrom stick up the anus. like what happened to 3 indian boys in Klang late last year
yeah.. people forget about that one. i think there are more reports of pulis people giving people in lockup their first anal moment than anwar in the last 10 years1 seriously. what an honourable institution we have here dear tamin. a police force who made it their business to give a man their first anal experience (lube is optional i heard)
as for the DNA
if i remembered correctly the DAN expecrt used during the anwar case was not really an expert. Fernando owns him during cross examination but the Judge still accept his statement.
maybe after that famous case in 98 they dump the matress and other anwar dna. tidak berfikir kedepan to use it again.
asking for new DNA sample is dumb. they must still have the DNA codes locked away in the court files. or maybe the dumb pulis lost the evidence. this is a possibility here since we are talking about malaysia. we can even lose the IMIGRESEN record of a mongolian model! if that pun boleh hilang you expect them to not loss anwar DNA ke? lol
hahahaha
This is freaking hilarious.
First of all, I just wanna say, dude you wrote about politics! I mean, dude! Tamin writes politics! Dude! Wait a minute. This is no Tamin. You must be some alien shit who takes over his body or something! Give him back you alien mofo!
FYI Malaysian CSI doesn’t need to use the Horatio I-don’t-need-no-need-fucking-evidence Cane methods to solve crimes. Instead, they have their own way.
Just imagine this first episode of Malaysian CSI. A jewellery shop being robbed. So a group of Malaysian CSI went there, not to collect evidences, just to show to the press, “Okay I acknowledge, there was a robbery here.” So what they do is that, they identify a suspect, caught him, torture him to death, make him to confess even though he didn’t do it, name a few people so that they can torture some more, and walla! Crime Solved! Doesn’t need no freaking super gadget or whatsoever. CSI Miami took a week to solve a crime, Malaysian CSI took only a day! And then repeat for the next episode. Different crime scene, same fucking method.
hahaha..
nicely put.
heh~ nice one–
really nice one..
or perhaps they didn’t do it the first time either…
the hidden agenda that’s not really a hidden stuff anyway–
sengaja mahu membutakan kita yang disangka bahlol sedangkan mata kita tak pernah berkelip walau sekali pun
Obefiend: And I’m glad to be back, kind sir!
And I think you’re right. It’s not the first time Malaysia’s finest have been able to produce ‘evidence’ on a whim.
Iceroll: Ya mate. Not really about the politics, but about the stupidity that is so obvious in the politics.
Broken_nigina: Thanks! I thought it was quite nicely written myself.
Hani: And it’s amazing how in this age of internet and connectivity and information, they still think they can buat ikut suka hati diorang and think we won’t find out about that shit. Ingat orang bodoh ke apa?
Appreciate your comments!
funny & witty ^__~ but do cutdown on the taking-god’s-name-in-vain part.
Thank you for another magnificent post. The place else could anyone get that type of info in such an ideal method of writing? I’ve a presentation next week, and I’m on the look for such info.